wound model raises a handful of sensible questions. This page answers them in order, starting with the fundamentals and moving to applications.
This page was last updated on 2026-02-13 and is reviewed periodically as new material appears.
Literature and online discussion often conflate TB-500 with full-length thymosin beta-4, even though the two differ in size and are not interchangeable in analytical terms. The fragment is produced by solid-phase peptide synthesis, and the product is a defined seven-residue chain rather than a biological extract. Because the term is a trade-style label, two vendors may supply materials of the same nominal sequence but different counter-ion content, purity, or water content. Comparisons across studies are therefore difficult unless the exact sequence and purity are reported.
TB-500 is a research peptide whose sequence matches residues 17 to 23 of thymosin beta-4, a 43-residue protein present in most mammalian cells. The chain is seven amino acids long, written as LKKTETQ, and is normally supplied with an acetyl group on the N-terminus. Suppliers list it as a lyophilised powder under the code name TB-500, and the same sequence appears elsewhere in catalogues as the thymosin beta-4 actin-binding fragment. The label is commercial rather than systematic, so no single authority fixes exactly what TB-500 denotes.
Detection in biological samples relies on mass spectrometry, typically liquid chromatography coupled to tandem mass spectrometry after peptide extraction and enrichment. Intact peptides can also be confirmed by high-resolution mass measurement together with fragmentation data. Detection windows in urine are short because the peptide is degraded by proteases and cleared quickly, and concentrations are low. Many jurisdictions treat the compound as a prohibited substance in sport, grouped with peptide hormones and related factors, while it is not an approved therapeutic product. Identity and purity statements therefore rest on certificates of analysis, ideally issued by an independent laboratory.
Material is normally supplied as a lyophilised powder in a sealed vial. The powder is hygroscopic, so exposure to humid air leads to water uptake, caking and gradual loss of the fluffy texture that indicates a good freeze-dry. Vials are best kept sealed with desiccant, protected from light and stored cold. Letting a cold vial warm to room temperature before opening reduces condensation on the contents. Purity is normally reported from a chromatographic run, and that figure applies to the batch as tested rather than to the vial after repeated opening.
Once dissolved, the peptide is far less stable than the dry powder. Aqueous solutions are subject to hydrolysis, oxidation at susceptible residues and gradual loss of material through adsorption onto glass and plastic surfaces. Terminal glutamine can cyclise under some conditions, producing a related species that complicates purity assessment. Dilute solutions tend to lose a larger fraction of material to surfaces than concentrated ones. Buffers, pH and ionic strength all influence the rate of change, so stability figures are only meaningful when those parameters are stated alongside the storage interval.
| Property | Value | Notes |
|---|---|---|
| Appearance | White to off-white powder | Supplied as a lyophilised cake in sealed vials |
| Solubility class | Freely soluble in water | Polar and charged side chains dominate the sequence |
| Typical storage temperature | -20 °C or below | Dry and dark; a desiccant is often recommended |
| Identity confirmation | Mass spectrometry | Observed mass compared with the theoretical value |
| Common synonyms | Thymosin beta-4 fragment | Also written as T beta 4 fragment 17-23 |
Animal work has examined the peptide in models of cardiac injury, skin wounding, and corneal repair, with reported outcomes covering cell migration, inflammatory cell influx, and tissue remodeling. Several of those experiments used the full-length protein or longer fragments instead of the seven-residue sequence, which makes direct comparison between reports difficult. Results are generally described as tissue-dependent, and effect sizes vary considerably across laboratories. Independent replication is uneven, so the overall picture is incomplete rather than settled.
Controlled human trials of the short fragment are scarce. Much of what appears in review articles is extrapolated from animal models or from studies of the parent protein, and literature searches return a larger body of cardiac and ophthalmic work on thymosin beta-4 than on the abbreviated peptide. Regulatory treatment differs by jurisdiction, and in several countries the material is handled as a research chemical rather than an approved therapeutic. Statements about human benefit should be read as provisional.
Biological interest in this peptide centers on its relationship to actin dynamics. Thymosin beta-4 binds monomeric actin through an LKKTET motif, and a short sequence carrying that motif can compete with other actin-binding proteins in cell-free preparations. Investigators propose that such competition shifts the balance between filament assembly and disassembly, which in turn affects how readily a cell extends protrusions and migrates. Most of the supporting observations come from cultured cells and purified protein systems rather than from intact organisms.
Identity and purity are checked with reversed-phase high-performance liquid chromatography, which separates the target sequence from truncated or deletion analogues, and with mass spectrometry, which confirms the expected molecular mass. Amino acid analysis and peptide mapping give orthogonal confirmation but are used less often outside specialist laboratories. Counter-ion content varies: material purified on trifluoroacetic acid gradients retains trifluoroacetate, and ion exchange can convert the salt form. Residual water and solvent are measured by Karl Fischer titration or thermogravimetric analysis, and any purity figure should be read together with the method used to obtain it.
Lyophilised peptide powders are hygroscopic, and the fragment absorbs atmospheric moisture when a vial is opened at room temperature. Weighing and aliquoting are normally done quickly in a dry environment, and stock solutions are divided into single-use portions before freezing. Repeated freeze-thaw cycles are avoided because they promote aggregation and can shift the measured content of a vial. These practices are general to synthetic peptides rather than unique to this sequence, but they matter more for short chains kept for long periods.
Regulatory status differs by country, but TB-500 is not an approved pharmaceutical in major jurisdictions. It is commonly sold as a research chemical for laboratory use, which places responsibility for identity and purity on the supplier and the laboratory. Published human data are limited, and most reports involve preclinical models or cell culture. Questions about whether the fragment mimics all actions of thymosin beta-4, and under which conditions, remain open. Independent verification of any material is therefore a practical requirement in research settings.
TB-500 is a synthetic heptapeptide with the sequence Ac-LKKTETQ. It corresponds to a short N-terminal region of thymosin beta-4, a 43-amino-acid protein found in many cell types. The fragment contains an actin-binding motif, which is one reason it appears in laboratory studies of cell migration and cytoskeletal dynamics. TB-500 is not the full-length protein and is produced as a research chemical rather than an approved therapeutic agent. Its molecular weight is approximately 889 Da.
January 22 The United States leaves the World Health Organization. Trump's Executive Order 14253 is carried out, removing exhibits commemorating the history of slavery in the United States at the President's House. January 23 – The Office of Foreign Assets Control imposes sanctions on British-Palestinian activist Zaher Birawi, alleging that he has ties with Hamas. January 23–26 – A major winter storm and cold wave impact over 30 states and kill at least 85 people, with over 15 states of emergency being declared.
Internal aldimine formation: First, the ε-amino group of Lys258 forms a Schiff base linkage with the aldehyde carbon to generate an internal aldimine. Transaldimination: The internal aldimine then becomes an external aldimine when the ε-amino group of Lys258 is displaced by the amino group of aspartate. This transaldimination reaction occurs via a nucleophilic attack by the deprotonated amino group of Asp and proceeds through a tetrahedral intermediate. As this point, the carboxylate groups of Asp are stabilized by the guanidinium groups of the enzyme's Arg386 and Arg292 residues. Quinonoid formation: The hydrogen attached to the α-carbon of Asp is then abstracted (Lys258 is thought to be the proton acceptor) to form a quinonoid intermediate. Ketimine formation: The quinonoid is reprotonated, but now at the aldehyde carbon, to form the ketimine intermediate. Ketimine hydrolysis: Finally, the ketimine is hydrolyzed to form PMP and oxaloacetate. This mechanism is thought to have multiple partially rate-determining steps. However, it has been shown that the substrate binding step (transaldimination) drives the catalytic reaction forward.
DNA nanotechnology uses the unique molecular recognition properties of DNA and other nucleic acids to create self-assembling branched DNA complexes with useful properties. DNA is thus used as a structural material rather than as a carrier of biological information. This has led to the creation of two-dimensional periodic lattices (both tile-based and using the DNA origami method) and three-dimensional structures in the shapes of polyhedra. Nanomechanical devices and algorithmic self-assembly have also been demonstrated, and these DNA structures have been used to template the arrangement of other molecules such as gold nanoparticles and streptavidin proteins. DNA and other nucleic acids are the basis of aptamers, synthetic oligonucleotide ligands for specific target molecules used in a range of biotechnology and biomedical applications.
RNA sequencing (RNA-seq) RNA-seq is a high-throughput RNA sequencing technology that allows scientists to profile the entire RNA (transcriptome). Therefore, novel transcripts and gene expression level can be identified based on cDNA libraries. This method can be used for cancer diagnosis and treatment evaluation. Reverse transcription polymerase chain reaction (RT-PCR) RT-PCR is a widely used mRNA expression detection method. It enables reverse transcription of mRNA to cDNA for further identification and qualification. In early 1992, RT-PCR was applied in PSA gene expression in peripheral blood for early prostate cancer diagnosis. Digital PCR (dPCR) dPCR is a relatively accurate quantification method of measuring the initial concentration of mRNA targets. It can be applied to analyze genetic and epigenetic changes. In-situ hybridization (ISH) ISH is a tissue dependent visualization method of identifying mRNA targeted in the samples. The "tissue" can be blood sample. In chronic myeloid leukemia, ISH has been applied on peripheral-blood specimens.
Found with almost all other rare-earth metals but never by itself, lutetium is very difficult to separate from other elements. Its principal commercial source is as a by-product from the processing of the rare earth phosphate mineral monazite (Ce,La,...)PO4, which has concentrations of only 0.0001% of the element, not much higher than the abundance of lutetium in the Earth crust of about 0.5 mg/kg. No lutetium-dominant minerals are currently known. The main mining areas are China, United States, Brazil, India, Sri Lanka and Australia. The world production of lutetium (in the form of oxide) is about 10 tonnes per year. Pure lutetium metal is very difficult to prepare. It is one of the rarest and most expensive of the rare earth metals with the price about US$10,000 per kilogram, or about one-fourth that of gold. Crushed minerals are treated with hot concentrated sulfuric acid to produce water-soluble sulfates of rare earths. Thorium precipitates out of solution as hydroxide and is removed. After that the solution is treated with ammonium oxalate to convert rare earths into their insoluble oxalates. The oxalates are converted to oxides by annealing. The oxides are dissolved in nitric acid that excludes one of the main components, cerium, whose oxide is insoluble in HNO3. Several rare earth metals, including lutetium, are separated as a double salt with ammonium nitrate by crystallization. Lutetium is separated by ion exchange.
Sources: en.wikipedia.org
=== Pyrolysis === In the typical operating temperature range of e-cigarettes (250–400 °C (482–752 °F)), 25–52% of CBD is transformed into other chemical substances: Δ9-THC, Δ8-THC, cannabinol and cannabichromene as predominant pyrolysates. From a chemical point of view, CBD in e-cigarettes can be considered a precursor of THC.
Pellucid marginal degeneration (PMD) is a degenerative corneal condition, often confused with keratoconus. It typically presents with painless vision loss affecting both eyes. Rarely, it may cause acute vision loss with severe pain due to perforation of the cornea. It is typically characterized by a clear, bilateral thinning (ectasia) in the inferior and peripheral region of the cornea, although some cases affect only one eye. The cause of the disease remains unclear. Pellucid marginal degeneration is diagnosed by corneal topography. Corneal pachymetry may be useful in confirming the diagnosis. Treatment usually consists of vision correction with eyeglasses or contact lenses. Intacs implants, corneal collagen cross-linking, and corneal transplant surgery are additional options. Surgery is reserved for individuals who do not tolerate contact lenses. The term pellucid marginal degeneration was coined in 1957 by the ophthalmologist Schalaeppi. The word "pellucid" means clear, indicating that the corneas retain clarity in pellucid marginal degeneration. The condition is rare, though the exact prevalence and incidence are unknown.
Arab and Persian chemists distilled crude oil to produce flammable products for military purposes. Through Islamic Spain, distillation became available in Western Europe by the 12th century. It was present in Romania since the 13th century, being recorded as păcură. Sophisticated oil pits, 4.5 to 6 metres (15 to 20 ft) deep, were dug by the Seneca people and other Iroquois in Western Pennsylvania as early as 1415–1450. The French General Louis-Joseph de Montcalm encountered Seneca using petroleum for ceremonial fires and as a healing lotion during a visit to Fort Duquesne in 1750. Early British explorers to Myanmar documented a flourishing oil extraction industry based in Yenangyaung that, in 1795, had hundreds of hand-dug wells under production. Merkwiller-Pechelbronn is said to be the first European site where petroleum has been explored and used.
=== Polyadenylation === Based on software analysis of the mRNA sequences various polyadenylation patterns could be identified for the transcription variants . TV1 and TV2 share the same pattern located on exon 10 starting at position 1246 resulting in a 32 nucleotide motif (AGUAGAGUCUGCGCUGUGACCUUCUGUUGGGC). TV3 uses a motif on exon 11 at the position 320. The motif is also 32 nucleotides long, but differs from the sequence used by TV1/2 (AGUGGCUUGUUCCACCUCAGCUCCCAUCUAAC). The difference in the polyadenylation sequence results in a variance of the minimum free energy values of the predicted RNA folding structures (-28.70 kcal/mol, TV1 and TV2 and -16.03 kcal/mol, TV3), which could result in different length of the Poly-A tail. Based on the observation that stable secondary structures result in decreased polyadenylation of the specific site, this might indicate that TV1 and TV2 are less polyadenylated in comparison to TV3.
Sources: en.wikipedia.org
No. Thymosin beta-4 is a 43-residue protein, while TB-500 matches only residues 17 to 23 of that chain. The two are related but differ in size, and a method that identifies one does not automatically identify the other.
It corresponds to the actin-binding region of thymosin beta-4. Commercial synthesis reproduces that seven-residue stretch, usually with an acetyl group on the N-terminus.
It is not authorised as a medicine in the United States or the European Union and is distributed as a research chemical. Labels consequently carry research-use-only statements rather than clinical indications.
Sealed, dry and protected from light at reduced temperature is the usual laboratory convention. Allowing a cold vial to reach room temperature before opening limits condensation. Repeated opening exposes the powder to moisture and should be minimised.